ID: 1064548543_1064548547

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1064548543 1064548547
Species Human (GRCh38) Human (GRCh38)
Location 10:16475461-16475483 10:16475474-16475496
Sequence CCAGATTCTTACATTGCAACTCG TTGCAACTCGGGGTTTTGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 56} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!