ID: 1064552714_1064552730

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1064552714 1064552730
Species Human (GRCh38) Human (GRCh38)
Location 10:16520254-16520276 10:16520306-16520328
Sequence CCAGACTCCGGAACTGCCCTCTC GACCCCCGCCTCTCCAGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 183} {0: 1, 1: 0, 2: 2, 3: 8, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!