ID: 1064552724_1064552730

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1064552724 1064552730
Species Human (GRCh38) Human (GRCh38)
Location 10:16520291-16520313 10:16520306-16520328
Sequence CCCTCCTGCGCGCACGACCCCCG GACCCCCGCCTCTCCAGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 66} {0: 1, 1: 0, 2: 2, 3: 8, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!