ID: 1064584741_1064584747

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1064584741 1064584747
Species Human (GRCh38) Human (GRCh38)
Location 10:16828821-16828843 10:16828866-16828888
Sequence CCAGAGGATGGAGAGCTGGCGTT TAGTTCTGGACACAGTCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 125} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!