ID: 1064594712_1064594715

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1064594712 1064594715
Species Human (GRCh38) Human (GRCh38)
Location 10:16931971-16931993 10:16932006-16932028
Sequence CCATTACATGAAAAGTTTTAAAT AGGAAGGCTTAGATGTGAAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 54, 4: 653} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!