ID: 1064757678_1064757681

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1064757678 1064757681
Species Human (GRCh38) Human (GRCh38)
Location 10:18586694-18586716 10:18586740-18586762
Sequence CCCAAAGAGTCAGCGGCAGCAAG CAAAGTTTCCACTATGTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 21, 2: 1169, 3: 1493, 4: 819} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!