ID: 1064764753_1064764768

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1064764753 1064764768
Species Human (GRCh38) Human (GRCh38)
Location 10:18659547-18659569 10:18659588-18659610
Sequence CCTCGGCTCCGCGCAGCCCGCGC GCAGCGGCACCTGCTGCCGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 356} {0: 1, 1: 0, 2: 1, 3: 14, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!