ID: 1064780775_1064780780

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1064780775 1064780780
Species Human (GRCh38) Human (GRCh38)
Location 10:18835887-18835909 10:18835916-18835938
Sequence CCAACGACTGATAAATATACCAT TCCTTCTCAGGTTAAATCTAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!