ID: 1064808774_1064808775 |
View in Genome Browser |
Spacer: -7 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1064808774 | 1064808775 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 10:19168644-19168666 | 10:19168660-19168682 |
| Sequence | CCTTATTATCTGGGGGCATATTA | CATATTAACTAGTTTGTAGATGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 0, 2: 0, 3: 13, 4: 288} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||