ID: 1065077900_1065077908

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1065077900 1065077908
Species Human (GRCh38) Human (GRCh38)
Location 10:22099186-22099208 10:22099226-22099248
Sequence CCACAACCTTCCATCTGTAAGCT TTTGAGGGCCAGAAGCATCAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 11, 3: 89, 4: 486} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!