ID: 1065110398_1065110409

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1065110398 1065110409
Species Human (GRCh38) Human (GRCh38)
Location 10:22435619-22435641 10:22435666-22435688
Sequence CCACTTCATGCTTTCTGCCCCCT CTCTAACTCTCCCACTTCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 42, 4: 448} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!