ID: 1065110405_1065110409

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1065110405 1065110409
Species Human (GRCh38) Human (GRCh38)
Location 10:22435639-22435661 10:22435666-22435688
Sequence CCTTTGGGGAAAGTATGCCTCAC CTCTAACTCTCCCACTTCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 133} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!