ID: 1065112676_1065112683

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1065112676 1065112683
Species Human (GRCh38) Human (GRCh38)
Location 10:22455301-22455323 10:22455324-22455346
Sequence CCGGCCAGGGGCCACCTCTACTT CTGCTGGGGCCTCCCAATGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 38, 4: 341}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!