ID: 1065112686_1065112695

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1065112686 1065112695
Species Human (GRCh38) Human (GRCh38)
Location 10:22455336-22455358 10:22455366-22455388
Sequence CCCAATGCTGGCCCTCCACAGGT GGAAACAACCCTCAGAAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 206} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!