ID: 1065128759_1065128763

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1065128759 1065128763
Species Human (GRCh38) Human (GRCh38)
Location 10:22599774-22599796 10:22599798-22599820
Sequence CCTAGCTCAAACCACAAAAGCTG TTGAGGCTCTGGTGCTATCTCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 11, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!