ID: 1065168256_1065168258

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1065168256 1065168258
Species Human (GRCh38) Human (GRCh38)
Location 10:23003067-23003089 10:23003102-23003124
Sequence CCTTAAGAAGGGCAGATTTGTCT CAGTATTACTTTATCTAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 140} {0: 1, 1: 0, 2: 0, 3: 12, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!