ID: 1065170002_1065170004

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1065170002 1065170004
Species Human (GRCh38) Human (GRCh38)
Location 10:23017655-23017677 10:23017670-23017692
Sequence CCTGGGAGGCTGAAGCAGGAGAA CAGGAGAATCAGCTTGAGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 17, 3: 109, 4: 576}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!