ID: 1065178419_1065178423

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1065178419 1065178423
Species Human (GRCh38) Human (GRCh38)
Location 10:23100796-23100818 10:23100826-23100848
Sequence CCAAACCATATCAGAGGCAGTCA CACTGTGACAAGATGGAAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 98, 4: 631} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!