ID: 1065188946_1065188957

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1065188946 1065188957
Species Human (GRCh38) Human (GRCh38)
Location 10:23193312-23193334 10:23193333-23193355
Sequence CCCGTAAGTGCTTCCGCTTCCCA CAGCTCAGGGAGAAGGGGTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 88} {0: 1, 1: 1, 2: 5, 3: 75, 4: 1463}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!