ID: 1065196495_1065196497

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1065196495 1065196497
Species Human (GRCh38) Human (GRCh38)
Location 10:23270909-23270931 10:23270924-23270946
Sequence CCAGGGTTATATGTACAGAACTC CAGAACTCTGATCTCTCCCTGGG
Strand - +
Off-target summary No data {0: 18, 1: 67, 2: 77, 3: 78, 4: 294}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!