ID: 1065215083_1065215088

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1065215083 1065215088
Species Human (GRCh38) Human (GRCh38)
Location 10:23440156-23440178 10:23440181-23440203
Sequence CCCCAGGGGCTGGGAGAGGGGCG GATCGCTGCGACGCGCCCGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 87, 4: 720} {0: 1, 1: 0, 2: 0, 3: 0, 4: 26}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!