ID: 1065215086_1065215088

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1065215086 1065215088
Species Human (GRCh38) Human (GRCh38)
Location 10:23440158-23440180 10:23440181-23440203
Sequence CCAGGGGCTGGGAGAGGGGCGGC GATCGCTGCGACGCGCCCGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 15, 3: 214, 4: 1354} {0: 1, 1: 0, 2: 0, 3: 0, 4: 26}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!