ID: 1065222790_1065222798

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1065222790 1065222798
Species Human (GRCh38) Human (GRCh38)
Location 10:23513330-23513352 10:23513377-23513399
Sequence CCCTGCCGGATCCGGAGTGGTGA AGGCAAACAGCAGTAGTGGACGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 112, 3: 117, 4: 303}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!