ID: 1065229510_1065229514

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1065229510 1065229514
Species Human (GRCh38) Human (GRCh38)
Location 10:23582918-23582940 10:23582943-23582965
Sequence CCTTAACTGTGAGTTTACCTAAG TGGTACCCACTGATGGAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 146} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!