ID: 1065297711_1065297714

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1065297711 1065297714
Species Human (GRCh38) Human (GRCh38)
Location 10:24292430-24292452 10:24292453-24292475
Sequence CCTTTACAGGAAGGCCATTTGCC TCACTCATCAGAAGTATTAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 92} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!