ID: 1065428341_1065428348

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1065428341 1065428348
Species Human (GRCh38) Human (GRCh38)
Location 10:25628786-25628808 10:25628830-25628852
Sequence CCGAGGATGATGGCCTCCACCTC CATGGCCTTGTTTTGTTTTATGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 80, 3: 231, 4: 541} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!