ID: 1065464431_1065464438

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1065464431 1065464438
Species Human (GRCh38) Human (GRCh38)
Location 10:26004017-26004039 10:26004049-26004071
Sequence CCCTTCAATCCTTCCTTTCTTTA TAGAACAAAAGCCATTGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 427, 4: 2824} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!