ID: 1065467977_1065467979

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1065467977 1065467979
Species Human (GRCh38) Human (GRCh38)
Location 10:26045685-26045707 10:26045698-26045720
Sequence CCTCCTTTCATCTGCTCCTTTTG GCTCCTTTTGCTCCCCAAGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 2, 3: 32, 4: 437}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!