ID: 1065480898_1065480905

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1065480898 1065480905
Species Human (GRCh38) Human (GRCh38)
Location 10:26192990-26193012 10:26193024-26193046
Sequence CCCTTAGCTCTCAAAGTCCTAGA CTAGAGGAAAGCACATGGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 55, 4: 445} {0: 1, 1: 0, 2: 1, 3: 8, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!