ID: 1065493430_1065493434

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1065493430 1065493434
Species Human (GRCh38) Human (GRCh38)
Location 10:26305573-26305595 10:26305596-26305618
Sequence CCATGGCCTGTGGCTCAGAAAAT CTGGTGAGGCTACGTGTTTCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!