ID: 1065509828_1065509830

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1065509828 1065509830
Species Human (GRCh38) Human (GRCh38)
Location 10:26467204-26467226 10:26467223-26467245
Sequence CCTTCTAATGCATTTTTAACTTT CTTTGAGAATAGAAGTATGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 15, 3: 102, 4: 844} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!