ID: 1065528167_1065528170

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1065528167 1065528170
Species Human (GRCh38) Human (GRCh38)
Location 10:26643277-26643299 10:26643300-26643322
Sequence CCACGCTGACTTGTCGCATGTGC ACCAAGGCCAGCCCCACTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 11, 4: 43} {0: 1, 1: 0, 2: 11, 3: 31, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!