ID: 1065554930_1065554945

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1065554930 1065554945
Species Human (GRCh38) Human (GRCh38)
Location 10:26905774-26905796 10:26905825-26905847
Sequence CCTCCCCGGGGGCAGGGCTTGGG CCCCGAGCTGTGGGCTCCTGTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 8, 3: 55, 4: 419} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!