ID: 1065599096_1065599102

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1065599096 1065599102
Species Human (GRCh38) Human (GRCh38)
Location 10:27350247-27350269 10:27350264-27350286
Sequence CCCACCCTGCCTGCCGGGCCCAG GCCCAGCCCCGCCAGCAACACGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 12, 3: 59, 4: 542} {0: 1, 1: 0, 2: 3, 3: 30, 4: 303}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!