ID: 1065644087_1065644091

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1065644087 1065644091
Species Human (GRCh38) Human (GRCh38)
Location 10:27816417-27816439 10:27816444-27816466
Sequence CCAGCATCGTTCAATATCCTAGG ACACAGAGGAAATAGATTATAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 16, 3: 30, 4: 322}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!