ID: 1065654582_1065654588

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1065654582 1065654588
Species Human (GRCh38) Human (GRCh38)
Location 10:27934951-27934973 10:27934979-27935001
Sequence CCTCCCAAGTGTTCTCCCTAACA ATAAAATCTTTCCATCTCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 161} {0: 1, 1: 0, 2: 2, 3: 27, 4: 355}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!