ID: 1065667435_1065667438

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1065667435 1065667438
Species Human (GRCh38) Human (GRCh38)
Location 10:28077203-28077225 10:28077243-28077265
Sequence CCTAGGTAATATGCTAACTTTAT CAAGCTCACGACACCCATGTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!