ID: 1065704530_1065704533

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1065704530 1065704533
Species Human (GRCh38) Human (GRCh38)
Location 10:28460020-28460042 10:28460035-28460057
Sequence CCAAACCTTAGCTTTGTTCTCAG GTTCTCAGTGGCTCCCAACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 228} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!