ID: 1065722764_1065722768

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1065722764 1065722768
Species Human (GRCh38) Human (GRCh38)
Location 10:28642498-28642520 10:28642524-28642546
Sequence CCTACCTCTTTCTTCTTCTACTA CGCTCCTACTCACTGGAAGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!