ID: 1065731406_1065731411

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1065731406 1065731411
Species Human (GRCh38) Human (GRCh38)
Location 10:28712851-28712873 10:28712886-28712908
Sequence CCATCTATGAGGAATGGGCCCTC ATCTGATGGTGCCTTGATTTTGG
Strand - +
Off-target summary {0: 17, 1: 45, 2: 122, 3: 201, 4: 394} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!