ID: 1065804586_1065804590

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1065804586 1065804590
Species Human (GRCh38) Human (GRCh38)
Location 10:29382889-29382911 10:29382905-29382927
Sequence CCAGGGAAGGATGCCAGCTTCTG GCTTCTGCACTGAAGGAAAAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 32, 4: 231} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!