ID: 1065820858_1065820862

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1065820858 1065820862
Species Human (GRCh38) Human (GRCh38)
Location 10:29523939-29523961 10:29523971-29523993
Sequence CCGGCATACATTGGAGCAACCGT GGTAGACACTGATGTGTTCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 27} {0: 1, 1: 0, 2: 1, 3: 14, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!