ID: 1065827609_1065827616

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1065827609 1065827616
Species Human (GRCh38) Human (GRCh38)
Location 10:29586159-29586181 10:29586210-29586232
Sequence CCACACACACTCATTAAACAGCT AGGCTGGTTAATGCAATTTGAGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 1, 3: 20, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!