ID: 1065928563_1065928570

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1065928563 1065928570
Species Human (GRCh38) Human (GRCh38)
Location 10:30458219-30458241 10:30458234-30458256
Sequence CCCTCCTACCTGTACATAGTAAG ATAGTAAGTGGGGTTCAACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 106} {0: 1, 1: 0, 2: 2, 3: 3, 4: 57}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!