ID: 1065951902_1065951909

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1065951902 1065951909
Species Human (GRCh38) Human (GRCh38)
Location 10:30659839-30659861 10:30659866-30659888
Sequence CCCTACCAGTCTCCTGCTGGGGG CTGAGTCAGAAGAAGCAGAGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!