ID: 1065961136_1065961146

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1065961136 1065961146
Species Human (GRCh38) Human (GRCh38)
Location 10:30735203-30735225 10:30735228-30735250
Sequence CCCGCCCTCTTCTCCATTCTCCC CAGTGGGTATGAGAGGAAGACGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 43, 4: 435}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!