ID: 1065976229_1065976236

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1065976229 1065976236
Species Human (GRCh38) Human (GRCh38)
Location 10:30845264-30845286 10:30845313-30845335
Sequence CCTTTTCAGTCTTGGACATGCAT TTCTCCGGCTTCCCTCTCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 164} {0: 1, 1: 0, 2: 2, 3: 25, 4: 315}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!