ID: 1065976971_1065976977

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1065976971 1065976977
Species Human (GRCh38) Human (GRCh38)
Location 10:30850140-30850162 10:30850153-30850175
Sequence CCTGGCCAGCAACCTGCATCAGG CTGCATCAGGGCATAGTTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 207} {0: 1, 1: 0, 2: 0, 3: 4, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!