ID: 1066049464_1066049472

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1066049464 1066049472
Species Human (GRCh38) Human (GRCh38)
Location 10:31620580-31620602 10:31620599-31620621
Sequence CCTGTCACCCCCAGCCTTGGGTG GGTGCCAATGGGAGACTCCGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 8, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!