ID: 1066059193_1066059216

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1066059193 1066059216
Species Human (GRCh38) Human (GRCh38)
Location 10:31707315-31707337 10:31707365-31707387
Sequence CCCCTGGCCCACCATCGAGGTCA CCGGGGAACAGGGTCATGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 92} {0: 1, 1: 0, 2: 1, 3: 8, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!